Transcript: Mouse NM_010002.3

Mus musculus cytochrome P450, family 2, subfamily c, polypeptide 38 (Cyp2c38), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cyp2c38 (13097)
Length:
2869
CDS:
22..1494

Additional Resources:

NCBI RefSeq record:
NM_010002.3
NBCI Gene record:
Cyp2c38 (13097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257570 ATGGAGACAGAGGTCTAGAAG pLKO_005 78 CDS 100% 4.950 6.930 N Cyp2c38 n/a
2 TRCN0000216495 CCACTGCATTAAAGATTATTA pLKO.1 2624 3UTR 100% 15.000 12.000 N Cyp2c38 n/a
3 TRCN0000217033 CACATCACAAGAAGCATATAG pLKO.1 1891 3UTR 100% 13.200 10.560 N Cyp2c38 n/a
4 TRCN0000257555 ACTCATGACCCTAAGGAATTT pLKO_005 402 CDS 100% 13.200 9.240 N Cyp2c38 n/a
5 TRCN0000251996 TGGAAAGAGACAAGACGTTTC pLKO_005 379 CDS 100% 6.000 4.200 N Cyp2c38 n/a
6 TRCN0000251998 TGAGGATCGTGTTCGAGAAGA pLKO_005 444 CDS 100% 4.950 3.465 N Cyp2c38 n/a
7 TRCN0000251997 TACCACTCATACCACTCAATA pLKO_005 2648 3UTR 100% 0.000 0.000 N Cyp2c38 n/a
8 TRCN0000194373 CATTACCAGCTCTGCTTCATT pLKO.1 1465 CDS 100% 5.625 3.375 N Cyp2c38 n/a
9 TRCN0000193245 CGCTAATGGAAACTTTAAGAA pLKO.1 1263 CDS 100% 5.625 3.375 N Cyp2c38 n/a
10 TRCN0000250523 ATGTCATCTGCTCAATTATTT pLKO_005 548 CDS 100% 15.000 7.500 Y Cyp2c54 n/a
11 TRCN0000125825 CCCACTCCTTTCCCGATTATT pLKO.1 118 CDS 100% 15.000 7.500 Y Cyp2c39 n/a
12 TRCN0000125826 CCAAGGGAACAACAGTAGTAA pLKO.1 1166 CDS 100% 5.625 2.813 Y Cyp2c39 n/a
13 TRCN0000064107 CCTGTGACATTAAATTCAGAA pLKO.1 1133 CDS 100% 4.950 2.475 Y CYP2C9 n/a
14 TRCN0000193255 CCTGTGACATTAAATTCAGAA pLKO.1 1133 CDS 100% 4.950 2.475 Y Cyp2c38 n/a
15 TRCN0000125828 GCAGTGAAGGAAGCTCTGATT pLKO.1 265 CDS 100% 4.950 2.475 Y Cyp2c39 n/a
16 TRCN0000126973 GCCCTATACTGATGCCATGAT pLKO.1 1056 CDS 100% 4.950 2.475 Y Cyp2c50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010002.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.