Transcript: Mouse NM_010005.3

Mus musculus cytochrome P450, family 2, subfamily d, polypeptide 10 (Cyp2d10), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cyp2d10 (13101)
Length:
1681
CDS:
73..1587

Additional Resources:

NCBI RefSeq record:
NM_010005.3
NBCI Gene record:
Cyp2d10 (13101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127172 GTTGTGCTAGACCTGTTCACT pLKO.1 973 CDS 100% 3.000 2.400 N Cyp2d10 n/a
2 TRCN0000127169 CCTAGAAACCTTGGTGTCTTT pLKO.1 1504 CDS 100% 4.950 3.465 N Cyp2d10 n/a
3 TRCN0000127170 GAGAATCTGTTGACTGAGAAT pLKO.1 835 CDS 100% 4.950 3.465 N Cyp2d10 n/a
4 TRCN0000254965 AGGAAATCGATGCGGTCATAG pLKO_005 1079 CDS 100% 10.800 5.400 Y Cyp2d11 n/a
5 TRCN0000127171 CAATGGACTGAAGGCAATGAA pLKO.1 324 CDS 100% 5.625 2.813 Y Cyp2d10 n/a
6 TRCN0000126472 CCCTACACCAATGCTGTCATT pLKO.1 1141 CDS 100% 4.950 2.475 Y Cyp2d9 n/a
7 TRCN0000174036 CGCATCACAAGTCGTGACATT pLKO.1 1207 CDS 100% 4.950 2.475 Y Cyp2d12 n/a
8 TRCN0000127173 CTTTGAATATGAAGACCCTTA pLKO.1 663 CDS 100% 4.050 2.025 Y Cyp2d10 n/a
9 TRCN0000126473 GCTTTGAATATGAAGACCCTT pLKO.1 662 CDS 100% 2.640 1.320 Y Cyp2d9 n/a
10 TRCN0000175033 GCTTTGAATATGAAGACCCTT pLKO.1 662 CDS 100% 2.640 1.320 Y Cyp2d12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.