Transcript: Mouse NM_010128.4

Mus musculus epithelial membrane protein 1 (Emp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Emp1 (13730)
Length:
2721
CDS:
206..688

Additional Resources:

NCBI RefSeq record:
NM_010128.4
NBCI Gene record:
Emp1 (13730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010128.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097685 GCACTCAATGTATCTTGTATA pLKO.1 1577 3UTR 100% 13.200 18.480 N Emp1 n/a
2 TRCN0000326442 GCACTCAATGTATCTTGTATA pLKO_005 1577 3UTR 100% 13.200 18.480 N Emp1 n/a
3 TRCN0000097688 GTGTCAATCTACACTCATCAT pLKO.1 542 CDS 100% 4.950 6.930 N Emp1 n/a
4 TRCN0000097689 TGTCAATCTACACTCATCATT pLKO.1 543 CDS 100% 5.625 4.500 N Emp1 n/a
5 TRCN0000326367 TGTCAATCTACACTCATCATT pLKO_005 543 CDS 100% 5.625 4.500 N Emp1 n/a
6 TRCN0000097686 CCAGCTCTTCACTATGGAGAA pLKO.1 457 CDS 100% 4.050 2.835 N Emp1 n/a
7 TRCN0000326443 CCAGCTCTTCACTATGGAGAA pLKO_005 457 CDS 100% 4.050 2.835 N Emp1 n/a
8 TRCN0000097687 CCTACGGCAATGAAGATGCTA pLKO.1 366 CDS 100% 3.000 2.100 N Emp1 n/a
9 TRCN0000326444 CCTACGGCAATGAAGATGCTA pLKO_005 366 CDS 100% 3.000 2.100 N Emp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010128.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.