Transcript: Mouse NM_010137.3

Mus musculus endothelial PAS domain protein 1 (Epas1), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Epas1 (13819)
Length:
5352
CDS:
420..3044

Additional Resources:

NCBI RefSeq record:
NM_010137.3
NBCI Gene record:
Epas1 (13819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010137.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416474 AGGAAAGCTTTGGCGTCATTC pLKO_005 3414 3UTR 100% 10.800 15.120 N Epas1 n/a
2 TRCN0000436203 GTATCATGTGTGTCAACTATG pLKO_005 1426 CDS 100% 10.800 15.120 N Epas1 n/a
3 TRCN0000428636 GCAGCCCTGAGGACTACTATT pLKO_005 1864 CDS 100% 13.200 10.560 N Epas1 n/a
4 TRCN0000082304 CGACAGAATCTTGGAACTGAT pLKO.1 1193 CDS 100% 4.950 3.960 N Epas1 n/a
5 TRCN0000082306 CGTGAGAACCTGACTCTCAAA pLKO.1 849 CDS 100% 0.495 0.396 N Epas1 n/a
6 TRCN0000082303 CCTCCCTTGAATTACTTCTAA pLKO.1 3318 3UTR 100% 5.625 3.938 N Epas1 n/a
7 TRCN0000082307 GACAGAATCTTGGAACTGATT pLKO.1 1194 CDS 100% 4.950 3.465 N Epas1 n/a
8 TRCN0000082305 GCCTCATGTCTCCATGTTCAA pLKO.1 2450 CDS 100% 4.950 3.465 N Epas1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3518 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010137.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.