Transcript: Mouse NM_010200.3

Mus musculus fibroblast growth factor 13 (Fgf13), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Fgf13 (14168)
Length:
2509
CDS:
374..1111

Additional Resources:

NCBI RefSeq record:
NM_010200.3
NBCI Gene record:
Fgf13 (14168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066936 CCTCAGCTTAAGGGTATAGTT pLKO.1 563 CDS 100% 5.625 7.875 N Fgf13 n/a
2 TRCN0000066935 GTGTACTGAATGGAGGCAAAT pLKO.1 1065 CDS 100% 10.800 8.640 N Fgf13 n/a
3 TRCN0000059148 CAGCACTTACACTCTGTTTAA pLKO.1 661 CDS 100% 13.200 9.240 N FGF13 n/a
4 TRCN0000066933 CGTGACATACTCATCAATGAT pLKO.1 829 CDS 100% 5.625 3.938 N Fgf13 n/a
5 TRCN0000066937 TGGCTATTCAAGGAGTTCAAA pLKO.1 708 CDS 100% 5.625 3.938 N Fgf13 n/a
6 TRCN0000066934 GACAGCACTTACACTCTGTTT pLKO.1 659 CDS 100% 4.950 3.465 N Fgf13 n/a
7 TRCN0000059152 GAGATCATGAAAGGCAACCAT pLKO.1 905 CDS 100% 3.000 2.100 N FGF13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010200.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00559 pDONR223 100% 95.5% 99.5% None (many diffs) n/a
2 ccsbBroad304_00559 pLX_304 0% 95.5% 99.5% V5 (many diffs) n/a
Download CSV