Transcript: Mouse NM_010216.2

Mus musculus vascular endothelial growth factor D (Vegfd), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Vegfd (14205)
Length:
1930
CDS:
309..1385

Additional Resources:

NCBI RefSeq record:
NM_010216.2
NBCI Gene record:
Vegfd (14205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067809 CCCGAGTTAGTGCCTGTTAAA pLKO.1 849 CDS 100% 13.200 18.480 N Vegfd n/a
2 TRCN0000067810 CCCGCCATCCTTACTCAATTA pLKO.1 910 CDS 100% 13.200 18.480 N Vegfd n/a
3 TRCN0000419537 GTAGTAGGTGCCACTCGATTG pLKO_005 1689 3UTR 100% 6.000 8.400 N Vegfd n/a
4 TRCN0000067812 CACCAGATTTGCGGCAACTTT pLKO.1 581 CDS 100% 5.625 7.875 N Vegfd n/a
5 TRCN0000433375 AGGGCAATGCTCATGAGTTAT pLKO_005 1733 3UTR 100% 13.200 10.560 N Vegfd n/a
6 TRCN0000425215 CATGTCCGGGAGATCTCATTC pLKO_005 1150 CDS 100% 10.800 7.560 N Vegfd n/a
7 TRCN0000067811 CCTCATGATGTTCCATGTGTA pLKO.1 338 CDS 100% 4.950 3.465 N Vegfd n/a
8 TRCN0000067808 GCTTCTTTCTTATGCGGAATT pLKO.1 1757 3UTR 100% 0.000 0.000 N Vegfd n/a
9 TRCN0000414413 TTGTAGCTTCAGATGTCTTTG pLKO_005 1591 3UTR 100% 10.800 6.480 N Vegfd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00570 pDONR223 100% 84.7% 83.8% None (many diffs) n/a
2 ccsbBroad304_00570 pLX_304 0% 84.7% 83.8% V5 (many diffs) n/a
Download CSV