Transcript: Mouse NM_010228.3

Mus musculus FMS-like tyrosine kinase 1 (Flt1), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Flt1 (14254)
Length:
6280
CDS:
255..4256

Additional Resources:

NCBI RefSeq record:
NM_010228.3
NBCI Gene record:
Flt1 (14254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235425 ACGATCTTGCTGGGCATAAAG pLKO_005 1467 CDS 100% 13.200 18.480 N Flt1 n/a
2 TRCN0000235428 ATGGCTCAGGGTCGAAGTTAA pLKO_005 322 CDS 100% 13.200 18.480 N Flt1 n/a
3 TRCN0000009607 CGGAATCTTCAATCTACATAT pLKO.1 616 CDS 100% 13.200 18.480 N Flt1 n/a
4 TRCN0000009606 CGTGACCTTTAATCGTGCTTT pLKO.1 4348 3UTR 100% 4.950 6.930 N Flt1 n/a
5 TRCN0000235426 GCGGTCTTCTTCCGAAGTAAA pLKO_005 2609 CDS 100% 13.200 10.560 N Flt1 n/a
6 TRCN0000235429 GTCCCAGCTATAGTTACTAAA pLKO_005 5258 3UTR 100% 13.200 9.240 N Flt1 n/a
7 TRCN0000009608 CCACACCTGAAATCTACCAAA pLKO.1 3628 CDS 100% 4.950 3.465 N Flt1 n/a
8 TRCN0000009609 GCCTCAGATCACTTGGTTCAA pLKO.1 2324 CDS 100% 4.950 3.465 N Flt1 n/a
9 TRCN0000235427 ATTGAAGTCTGCTCGCTATTT pLKO_005 1388 CDS 100% 13.200 7.920 N Flt1 n/a
10 TRCN0000009610 CCATGAAGATAGACTTGAGAA pLKO.1 4057 CDS 100% 4.950 2.970 N Flt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.