Transcript: Mouse NM_010303.3

Mus musculus guanine nucleotide binding protein, alpha 13 (Gna13), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gna13 (14674)
Length:
6217
CDS:
181..1314

Additional Resources:

NCBI RefSeq record:
NM_010303.3
NBCI Gene record:
Gna13 (14674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435189 TCTACAGCAACGTGATCAAAG pLKO_005 443 CDS 100% 10.800 15.120 N GNA13 n/a
2 TRCN0000098145 GCAACCTTACACTAGGTGTTT pLKO.1 1577 3UTR 100% 4.950 3.960 N Gna13 n/a
3 TRCN0000098149 GCTGGGTGAGTCTGTAAAGTA pLKO.1 687 CDS 100% 5.625 3.938 N Gna13 n/a
4 TRCN0000098147 CCTTACAGAATCTCTGAACAT pLKO.1 972 CDS 100% 4.950 3.465 N Gna13 n/a
5 TRCN0000098146 CGCGATCAACACAGAGAACAT pLKO.1 1224 CDS 100% 4.950 3.465 N Gna13 n/a
6 TRCN0000098148 CCTTGTCTCTTCAAGTGAATT pLKO.1 915 CDS 100% 0.000 0.000 N Gna13 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2501 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02502 pDONR223 100% 90.7% 96.8% None (many diffs) n/a
2 ccsbBroad304_02502 pLX_304 59.8% 90.7% 96.8% V5 (many diffs) n/a
Download CSV