Transcript: Mouse NM_010324.2

Mus musculus glutamic-oxaloacetic transaminase 1, soluble (Got1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Got1 (14718)
Length:
2065
CDS:
151..1392

Additional Resources:

NCBI RefSeq record:
NM_010324.2
NBCI Gene record:
Got1 (14718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119792 CCACATGAGAAGACGTTTCTT pLKO.1 1530 3UTR 100% 5.625 4.500 N Got1 n/a
2 TRCN0000119793 CGATGGTACAATGGTACAGAT pLKO.1 514 CDS 100% 4.950 3.465 N Got1 n/a
3 TRCN0000119794 GATGGTACAATGGTACAGATA pLKO.1 515 CDS 100% 4.950 3.465 N Got1 n/a
4 TRCN0000034786 CCCTTCTTTGACTCAGCCTAT pLKO.1 808 CDS 100% 4.050 2.835 N GOT1 n/a
5 TRCN0000119795 CGAGTATTTGGTCAACGAGAA pLKO.1 1263 CDS 100% 4.050 2.835 N Got1 n/a
6 TRCN0000119796 GTCGAACAGAAGATTGCTAAT pLKO.1 319 CDS 100% 10.800 15.120 N Got1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00665 pDONR223 98.8% 87% 90.7% None (many diffs) n/a
2 ccsbBroad304_00665 pLX_304 0% 87% 90.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV