Transcript: Mouse NM_010327.2

Mus musculus glycoprotein Ib, beta polypeptide (Gp1bb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gp1bb (14724)
Length:
1847
CDS:
824..1444

Additional Resources:

NCBI RefSeq record:
NM_010327.2
NBCI Gene record:
Gp1bb (14724)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240604 CCAGACTCCTCACTGAATAAA pLKO_005 1669 3UTR 100% 15.000 10.500 N Gp1bb n/a
2 TRCN0000240605 ACAAGGACCTGCAAACTTTAC pLKO_005 1465 3UTR 100% 10.800 7.560 N Gp1bb n/a
3 TRCN0000240603 AGGTGGTGCATCCTAAGAAAG pLKO_005 1429 CDS 100% 10.800 7.560 N Gp1bb n/a
4 TRCN0000240606 ATTGGTGCTGACCGGCAACAA pLKO_005 1000 CDS 100% 4.950 3.465 N Gp1bb n/a
5 TRCN0000216659 CCAAACTGATTCCAGTACTAC pLKO.1 1589 3UTR 100% 4.950 3.465 N Gp1bb n/a
6 TRCN0000240607 CCAAACTGATTCCAGTACTAC pLKO_005 1589 3UTR 100% 4.950 3.465 N Gp1bb n/a
7 TRCN0000173799 CCATCCAAGAGTTCTCTCTCA pLKO.1 1380 CDS 100% 2.640 1.848 N Gp1bb n/a
8 TRCN0000173225 CTCCTCACTGAATAAACCGTT pLKO.1 1674 3UTR 100% 2.640 1.848 N Gp1bb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.