Transcript: Mouse NM_010344.4

Mus musculus glutathione reductase (Gsr), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gsr (14782)
Length:
2692
CDS:
303..1805

Additional Resources:

NCBI RefSeq record:
NM_010344.4
NBCI Gene record:
Gsr (14782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010344.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042338 CCCAAATTCTAAGGGCCTGAA pLKO.1 1244 CDS 100% 4.050 3.240 N Gsr n/a
2 TRCN0000042339 GCTGTTCATAAGTATGGGAAA pLKO.1 1527 CDS 100% 4.050 3.240 N Gsr n/a
3 TRCN0000334917 GCTGTTCATAAGTATGGGAAA pLKO_005 1527 CDS 100% 4.050 3.240 N Gsr n/a
4 TRCN0000042342 GTGTTGAAGTTCACACAGGTT pLKO.1 1101 CDS 100% 2.640 2.112 N Gsr n/a
5 TRCN0000334855 GTGTTGAAGTTCACACAGGTT pLKO_005 1101 CDS 100% 2.640 2.112 N Gsr n/a
6 TRCN0000042340 CGCCTGAACACCATCTATCAA pLKO.1 693 CDS 100% 5.625 3.938 N Gsr n/a
7 TRCN0000334854 CGCCTGAACACCATCTATCAA pLKO_005 693 CDS 100% 5.625 3.938 N Gsr n/a
8 TRCN0000042341 GAGGGTAAATTCAGTTGGCAT pLKO.1 639 CDS 100% 2.640 1.848 N Gsr n/a
9 TRCN0000334772 GAGGGTAAATTCAGTTGGCAT pLKO_005 639 CDS 100% 2.640 1.848 N Gsr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010344.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.