Transcript: Mouse NM_010445.2

Mus musculus H6 homeobox 1 (Hmx1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Hmx1 (15371)
Length:
1508
CDS:
1..999

Additional Resources:

NCBI RefSeq record:
NM_010445.2
NBCI Gene record:
Hmx1 (15371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070718 CGAGTCCACTTTCGATCTGAA pLKO.1 618 CDS 100% 4.950 6.930 N Hmx1 n/a
2 TRCN0000070719 GTGGTCTAAGTCCTGACACAA pLKO.1 356 CDS 100% 4.950 6.930 N Hmx1 n/a
3 TRCN0000422183 TCGATCTGAAGCGCTACCTGA pLKO_005 629 CDS 100% 2.640 3.696 N Hmx1 n/a
4 TRCN0000070720 CGGAGGTACAACGCGGTGGTA pLKO.1 309 CDS 100% 0.000 0.000 N Hmx1 n/a
5 TRCN0000413113 ATCTTGCAGGAACCCAGACAT pLKO_005 1320 3UTR 100% 4.950 3.465 N Hmx1 n/a
6 TRCN0000070721 CCGGTGCTCTACCACGAGAGT pLKO.1 811 CDS 100% 0.000 0.000 N Hmx1 n/a
7 TRCN0000014850 CTCCTCCTTCCTCATCGAGAA pLKO.1 48 CDS 100% 4.050 2.430 N HMX1 n/a
8 TRCN0000070722 CCTCCTCCTTCCTCATCGAGA pLKO.1 47 CDS 100% 0.880 0.528 N Hmx1 n/a
9 TRCN0000014851 GTGCCGGTGCTCTACCACGAA pLKO.1 808 CDS 100% 0.000 0.000 N HMX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.