Transcript: Mouse NM_010485.3

Mus musculus ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R) (Elavl1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Elavl1 (15568)
Length:
6030
CDS:
232..1212

Additional Resources:

NCBI RefSeq record:
NM_010485.3
NBCI Gene record:
Elavl1 (15568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010485.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276186 TTGTTAGTGTACAACTCATTT pLKO_005 1314 3UTR 100% 13.200 10.560 N ELAVL1 n/a
2 TRCN0000112085 CCCACAAATGTTAGACCAATT pLKO.1 1431 3UTR 100% 10.800 8.640 N Elavl1 n/a
3 TRCN0000308991 CCCACAAATGTTAGACCAATT pLKO_005 1431 3UTR 100% 10.800 8.640 N Elavl1 n/a
4 TRCN0000112088 CGAGGTTGAATCTGCAAAGCT pLKO.1 363 CDS 100% 3.000 2.400 N Elavl1 n/a
5 TRCN0000308990 CGAGGTTGAATCTGCAAAGCT pLKO_005 363 CDS 100% 3.000 2.400 N Elavl1 n/a
6 TRCN0000112087 CATTGGGAGAACGAATTTAAT pLKO.1 279 CDS 100% 15.000 10.500 N Elavl1 n/a
7 TRCN0000308993 CATTGGGAGAACGAATTTAAT pLKO_005 279 CDS 100% 15.000 10.500 N Elavl1 n/a
8 TRCN0000112089 GCCAATCCCAACCAGAACAAA pLKO.1 784 CDS 100% 5.625 3.938 N Elavl1 n/a
9 TRCN0000308925 GCCAATCCCAACCAGAACAAA pLKO_005 784 CDS 100% 5.625 3.938 N Elavl1 n/a
10 TRCN0000221646 ACCATGACAAACTATGAAGAA pLKO.1 1102 CDS 100% 4.950 3.465 N ELAVL1 n/a
11 TRCN0000221648 CCCATCACAGTGAAGTTTGCA pLKO.1 763 CDS 100% 3.000 2.100 N ELAVL1 n/a
12 TRCN0000285492 CCCATCACAGTGAAGTTTGCA pLKO_005 763 CDS 100% 3.000 2.100 N ELAVL1 n/a
13 TRCN0000276126 TACCAGTTTCAATGGTCATAA pLKO_005 723 CDS 100% 0.000 0.000 N ELAVL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010485.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.