Transcript: Mouse NM_010580.2

Mus musculus integrin beta 5 (Itgb5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Itgb5 (16419)
Length:
3275
CDS:
297..2747

Additional Resources:

NCBI RefSeq record:
NM_010580.2
NBCI Gene record:
Itgb5 (16419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067127 CGAGAGTTTGCCAAGTTCCAA pLKO.1 2550 CDS 100% 3.000 2.400 N Itgb5 n/a
2 TRCN0000335493 CGAGAGTTTGCCAAGTTCCAA pLKO_005 2550 CDS 100% 3.000 2.400 N Itgb5 n/a
3 TRCN0000067124 CGTGTATTGGTTACAAGTTAT pLKO.1 898 CDS 100% 13.200 9.240 N Itgb5 n/a
4 TRCN0000335491 CGTGTATTGGTTACAAGTTAT pLKO_005 898 CDS 100% 13.200 9.240 N Itgb5 n/a
5 TRCN0000067125 GCTGGCAGAGAACAATATCAA pLKO.1 1271 CDS 100% 5.625 3.938 N Itgb5 n/a
6 TRCN0000335492 GCTGGCAGAGAACAATATCAA pLKO_005 1271 CDS 100% 5.625 3.938 N Itgb5 n/a
7 TRCN0000067123 CGCCTTCAACAAGTTCAACAA pLKO.1 2622 CDS 100% 4.950 3.465 N Itgb5 n/a
8 TRCN0000335578 CGCCTTCAACAAGTTCAACAA pLKO_005 2622 CDS 100% 4.950 3.465 N Itgb5 n/a
9 TRCN0000067126 GTGTGAAGAATGCCTGTTGAT pLKO.1 401 CDS 100% 4.950 3.465 N Itgb5 n/a
10 TRCN0000335490 GTGTGAAGAATGCCTGTTGAT pLKO_005 401 CDS 100% 4.950 3.465 N Itgb5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.