Transcript: Mouse NM_010581.3

Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cd47 (16423)
Length:
1928
CDS:
134..1108

Additional Resources:

NCBI RefSeq record:
NM_010581.3
NBCI Gene record:
Cd47 (16423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431433 GAAGTTGAACAAATCGTATAT pLKO_005 307 CDS 100% 13.200 18.480 N Cd47 n/a
2 TRCN0000065436 CACCGAAGAAATGTTTGTGAA pLKO.1 283 CDS 100% 4.950 6.930 N Cd47 n/a
3 TRCN0000426202 ATCTCAGTCTCAGACTTAATC pLKO_005 389 CDS 100% 13.200 10.560 N Cd47 n/a
4 TRCN0000434435 AGGAGAAAGGAGGTTGCAAAT pLKO_005 567 CDS 100% 10.800 8.640 N Cd47 n/a
5 TRCN0000065434 GCAGAACTACTTGGATTAGTT pLKO.1 1031 CDS 100% 0.563 0.450 N Cd47 n/a
6 TRCN0000065433 CCCGTTCTGCTACTTTGATTT pLKO.1 1767 3UTR 100% 13.200 9.240 N Cd47 n/a
7 TRCN0000436247 CTCTTTCACCATTGCCATATT pLKO_005 895 CDS 100% 13.200 9.240 N Cd47 n/a
8 TRCN0000420286 TGGACTTGGCCTCATTGTAAT pLKO_005 814 CDS 100% 13.200 9.240 N Cd47 n/a
9 TRCN0000427533 GCTCAACTACTGTTTAGTAAC pLKO_005 185 CDS 100% 10.800 7.560 N Cd47 n/a
10 TRCN0000065435 CCATACGAATAAGAGAATCAT pLKO.1 700 CDS 100% 5.625 3.938 N Cd47 n/a
11 TRCN0000065437 CAATGTGTTTATGACAGCTTT pLKO.1 865 CDS 100% 4.950 3.465 N Cd47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.