Transcript: Mouse NM_010582.3

Mus musculus inter-alpha trypsin inhibitor, heavy chain 2 (Itih2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Itih2 (16425)
Length:
3139
CDS:
107..2959

Additional Resources:

NCBI RefSeq record:
NM_010582.3
NBCI Gene record:
Itih2 (16425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080237 CGATGGACATTATAAGGATTA pLKO.1 2899 CDS 100% 10.800 15.120 N Itih2 n/a
2 TRCN0000318041 CGATGGACATTATAAGGATTA pLKO_005 2899 CDS 100% 10.800 15.120 N Itih2 n/a
3 TRCN0000080235 CGCACTGTATTATGGCACCAA pLKO.1 2077 CDS 100% 2.640 2.112 N Itih2 n/a
4 TRCN0000318040 CGCACTGTATTATGGCACCAA pLKO_005 2077 CDS 100% 2.640 2.112 N Itih2 n/a
5 TRCN0000080233 GAAACTGTATGTGTATCCTTT pLKO.1 2975 3UTR 100% 4.950 3.465 N Itih2 n/a
6 TRCN0000318042 GAAACTGTATGTGTATCCTTT pLKO_005 2975 3UTR 100% 4.950 3.465 N Itih2 n/a
7 TRCN0000080234 GCCAAGAGATACATTGAGAAA pLKO.1 1235 CDS 100% 4.950 3.465 N Itih2 n/a
8 TRCN0000318039 GCCAAGAGATACATTGAGAAA pLKO_005 1235 CDS 100% 4.950 3.465 N Itih2 n/a
9 TRCN0000080236 CCTGTCATATCTAAAGGACAA pLKO.1 830 CDS 100% 4.050 2.835 N Itih2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.