Transcript: Mouse NM_010590.5

Mus musculus ajuba LIM protein (Ajuba), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ajuba (16475)
Length:
3503
CDS:
398..2041

Additional Resources:

NCBI RefSeq record:
NM_010590.5
NBCI Gene record:
Ajuba (16475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010590.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444930 CTATATCTGAGCTGACGTTAC pLKO_005 2032 CDS 100% 6.000 8.400 N Ajuba n/a
2 TRCN0000075551 CAAGGCTTTCTACAGCGTCAA pLKO.1 1549 CDS 100% 4.050 5.670 N Ajuba n/a
3 TRCN0000441502 TCTGTCGTCGCCTCCTGATTT pLKO_005 733 CDS 100% 13.200 10.560 N Ajuba n/a
4 TRCN0000074209 ACCTGTATCAAGTGCAACAAA pLKO.1 1433 CDS 100% 5.625 4.500 N AJUBA n/a
5 TRCN0000449953 AGCGGAGGCAAGGAGTGTATT pLKO_005 2088 3UTR 100% 13.200 9.240 N Ajuba n/a
6 TRCN0000075548 CCTGGCTTACTTCAGAGTTAT pLKO.1 3333 3UTR 100% 13.200 9.240 N Ajuba n/a
7 TRCN0000365046 CCTGTATCAAGTGCAACAAAG pLKO_005 1434 CDS 100% 10.800 7.560 N AJUBA n/a
8 TRCN0000075550 CACCTGTATCAAGTGCAACAA pLKO.1 1432 CDS 100% 4.950 3.465 N Ajuba n/a
9 TRCN0000075552 GCCACTTGATTCTAGAGAAGA pLKO.1 1644 CDS 100% 4.950 3.465 N Ajuba n/a
10 TRCN0000075549 GCTAACAGCATTGCTGCGTTT pLKO.1 1261 CDS 100% 4.050 2.835 N Ajuba n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010590.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.