Transcript: Mouse NM_010616.3

Mus musculus kinesin family member 12 (Kif12), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kif12 (16552)
Length:
2275
CDS:
127..2055

Additional Resources:

NCBI RefSeq record:
NM_010616.3
NBCI Gene record:
Kif12 (16552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010616.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426914 GGACCTTCACCTGGCTATTAG pLKO_005 533 CDS 100% 13.200 18.480 N Kif12 n/a
2 TRCN0000445025 ACTCTCAGCACTCTGCGATAT pLKO_005 1165 CDS 100% 10.800 15.120 N Kif12 n/a
3 TRCN0000421686 CAACCGCAGCCTATTGGCATT pLKO_005 984 CDS 100% 4.050 3.240 N Kif12 n/a
4 TRCN0000090397 CCAAGGCCTCTCTTCTTGTTA pLKO.1 2034 CDS 100% 5.625 3.938 N Kif12 n/a
5 TRCN0000444269 GAGCTCCTCACATACCTTGAA pLKO_005 774 CDS 100% 4.950 3.465 N Kif12 n/a
6 TRCN0000090396 CCTCTGTTACTGCCACCACTT pLKO.1 1608 CDS 100% 4.050 2.835 N Kif12 n/a
7 TRCN0000090395 GAAGGATCAGAAACTCCCATT pLKO.1 184 CDS 100% 4.050 2.835 N Kif12 n/a
8 TRCN0000116701 GAGATCTACAATGAGCAGGTT pLKO.1 604 CDS 100% 2.640 1.848 N KIF12 n/a
9 TRCN0000090394 GCAGGAGTTTATGCTGGAGAA pLKO.1 1392 CDS 100% 4.050 2.430 N Kif12 n/a
10 TRCN0000090393 CCATCTCTCTGTCTGTGAATT pLKO.1 2088 3UTR 100% 0.000 0.000 N Kif12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010616.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.