Transcript: Mouse NM_010681.4

Mus musculus laminin, alpha 4 (Lama4), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Lama4 (16775)
Length:
6046
CDS:
441..5891

Additional Resources:

NCBI RefSeq record:
NM_010681.4
NBCI Gene record:
Lama4 (16775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010681.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348431 GATATCTCGCAGAGCATATTT pLKO_005 4121 CDS 100% 15.000 21.000 N Lama4 n/a
2 TRCN0000094821 CCCAGATTAATGATGCGAAAT pLKO.1 3811 CDS 100% 10.800 15.120 N Lama4 n/a
3 TRCN0000335121 CCCAGATTAATGATGCGAAAT pLKO_005 3811 CDS 100% 10.800 15.120 N Lama4 n/a
4 TRCN0000094822 CGGGACCATGAGAAACAACAT pLKO.1 1959 CDS 100% 4.950 6.930 N Lama4 n/a
5 TRCN0000335119 CGGGACCATGAGAAACAACAT pLKO_005 1959 CDS 100% 4.950 6.930 N Lama4 n/a
6 TRCN0000094823 GCCCAGATTAATGATGCGAAA pLKO.1 3810 CDS 100% 4.050 5.670 N Lama4 n/a
7 TRCN0000094820 CGCTTACTTTAGTATTGTCAA pLKO.1 3209 CDS 100% 4.950 3.465 N Lama4 n/a
8 TRCN0000335120 CGCTTACTTTAGTATTGTCAA pLKO_005 3209 CDS 100% 4.950 3.465 N Lama4 n/a
9 TRCN0000094819 GCAGACTCAAACAACTGAGAA pLKO.1 4457 CDS 100% 4.950 3.465 N Lama4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010681.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.