Transcript: Mouse NM_010687.2

Mus musculus LARGE xylosyl- and glucuronyltransferase 1 (Large1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Large1 (16795)
Length:
4671
CDS:
1158..3428

Additional Resources:

NCBI RefSeq record:
NM_010687.2
NBCI Gene record:
Large1 (16795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313389 GTGCGAGTAGACTTCTATAAT pLKO_005 1737 CDS 100% 15.000 21.000 N Large1 n/a
2 TRCN0000034706 GTTCCGTTCCAACAAGCAATA pLKO.1 3305 CDS 100% 10.800 8.640 N LARGE1 n/a
3 TRCN0000093915 CCTGAGTATGATCGGAGATTT pLKO.1 3159 CDS 100% 13.200 9.240 N Large1 n/a
4 TRCN0000312358 CCTGAGTATGATCGGAGATTT pLKO_005 3159 CDS 100% 13.200 9.240 N Large1 n/a
5 TRCN0000313317 TCGTCTGTGCCGGATACAATG pLKO_005 1582 CDS 100% 10.800 7.560 N Large1 n/a
6 TRCN0000093917 CCACCTCATTGCTGATTCTAT pLKO.1 1667 CDS 100% 5.625 3.938 N Large1 n/a
7 TRCN0000312357 CCACCTCATTGCTGATTCTAT pLKO_005 1667 CDS 100% 5.625 3.938 N Large1 n/a
8 TRCN0000093914 CCTTAGCTGTTGAGAAAGTAA pLKO.1 3735 3UTR 100% 5.625 3.938 N Large1 n/a
9 TRCN0000312359 CCTTAGCTGTTGAGAAAGTAA pLKO_005 3735 3UTR 100% 5.625 3.938 N Large1 n/a
10 TRCN0000093918 CCCTAGTTTCGACATCACTAA pLKO.1 3284 CDS 100% 4.950 3.465 N Large1 n/a
11 TRCN0000093916 CCAACAAACATTACTCTGGAA pLKO.1 1792 CDS 100% 2.640 1.584 N Large1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.