Transcript: Mouse NM_010743.3

Mus musculus interleukin 1 receptor-like 1 (Il1rl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Il1rl1 (17082)
Length:
3071
CDS:
351..1364

Additional Resources:

NCBI RefSeq record:
NM_010743.3
NBCI Gene record:
Il1rl1 (17082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313700 CAAAGAGGACGCTCGACTTAT pLKO_005 480 CDS 100% 13.200 18.480 N Il1rl1 n/a
2 TRCN0000039057 GCTGCAATATCCCTGATTATT pLKO.1 697 CDS 100% 15.000 12.000 N Il1rl1 n/a
3 TRCN0000317222 GCTGCAATATCCCTGATTATT pLKO_005 697 CDS 100% 15.000 12.000 N Il1rl1 n/a
4 TRCN0000313698 GAACCTTCATGGCATGATAAG pLKO_005 1283 CDS 100% 10.800 8.640 N Il1rl1 n/a
5 TRCN0000313699 CCAACAATTGACCTGTATAAT pLKO_005 768 CDS 100% 15.000 10.500 N Il1rl1 n/a
6 TRCN0000039054 CCAACAGGAATCTCTGTCATT pLKO.1 1539 3UTR 100% 4.950 3.465 N Il1rl1 n/a
7 TRCN0000349460 CCAACAGGAATCTCTGTCATT pLKO_005 1539 3UTR 100% 4.950 3.465 N Il1rl1 n/a
8 TRCN0000039058 CGAAATGAAAGTTCCAGCAAT pLKO.1 1179 CDS 100% 4.950 3.465 N Il1rl1 n/a
9 TRCN0000039055 CGGATCTTTGTCTCAAGAGAT pLKO.1 558 CDS 100% 4.950 3.465 N Il1rl1 n/a
10 TRCN0000039056 GCTCGACTTATCCTGTGGAAT pLKO.1 490 CDS 100% 4.950 3.465 N Il1rl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.