Transcript: Mouse NM_010763.2

Mus musculus mannosidase, alpha, class 1A, member 2 (Man1a2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Man1a2 (17156)
Length:
7960
CDS:
612..2537

Additional Resources:

NCBI RefSeq record:
NM_010763.2
NBCI Gene record:
Man1a2 (17156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077085 CGGTGACTTGACTTACTATAA pLKO.1 1661 CDS 100% 13.200 18.480 N Man1a2 n/a
2 TRCN0000302935 CGGTGACTTGACTTACTATAA pLKO_005 1661 CDS 100% 13.200 18.480 N Man1a2 n/a
3 TRCN0000077084 CCAGAAGTAATTGAAACCTAT pLKO.1 2205 CDS 100% 4.950 3.960 N Man1a2 n/a
4 TRCN0000302851 CCAGAAGTAATTGAAACCTAT pLKO_005 2205 CDS 100% 4.950 3.960 N Man1a2 n/a
5 TRCN0000077086 CCTGGGATAATTACAGAACAT pLKO.1 1183 CDS 100% 4.950 3.465 N Man1a2 n/a
6 TRCN0000302850 CCTGGGATAATTACAGAACAT pLKO_005 1183 CDS 100% 4.950 3.465 N Man1a2 n/a
7 TRCN0000049631 CCTTTAGACCACTGGGTGTTT pLKO.1 2442 CDS 100% 4.950 3.465 N MAN1A2 n/a
8 TRCN0000077087 CTGGGCTTAGAAGATGTGTTA pLKO.1 813 CDS 100% 4.950 3.465 N Man1a2 n/a
9 TRCN0000049628 GCAGAAATTCAGACAGAGAAA pLKO.1 1014 CDS 100% 4.950 3.465 N MAN1A2 n/a
10 TRCN0000077083 GCCAGATTGTTGCCTTGAAAT pLKO.1 3308 3UTR 100% 13.200 7.920 N Man1a2 n/a
11 TRCN0000302849 GCCAGATTGTTGCCTTGAAAT pLKO_005 3308 3UTR 100% 13.200 7.920 N Man1a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.