Transcript: Mouse NM_010790.2

Mus musculus maternal embryonic leucine zipper kinase (Melk), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Melk (17279)
Length:
2914
CDS:
195..2126

Additional Resources:

NCBI RefSeq record:
NM_010790.2
NBCI Gene record:
Melk (17279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010790.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232393 ACGCAGAGCAGTGGCAAATAA pLKO_005 1406 CDS 100% 15.000 21.000 N Melk n/a
2 TRCN0000220738 GCCGAAGATTCCAGTTAGTAA pLKO.1 1499 CDS 100% 5.625 4.500 N Melk n/a
3 TRCN0000220736 CGGTTAGAACACCAGGGAATT pLKO.1 1606 CDS 100% 0.000 0.000 N Melk n/a
4 TRCN0000232394 AGTTAGTAAGAACCAGTATAA pLKO_005 1511 CDS 100% 13.200 9.240 N Melk n/a
5 TRCN0000232391 CTGGAGAGATGGTAGCTATAA pLKO_005 292 CDS 100% 13.200 9.240 N Melk n/a
6 TRCN0000232395 CTGTTAAGTAGAGACTATTTG pLKO_005 2529 3UTR 100% 13.200 9.240 N Melk n/a
7 TRCN0000220735 GCCTGGGTTTACAAGAGATTA pLKO.1 2073 CDS 100% 13.200 9.240 N Melk n/a
8 TRCN0000232392 TGGACCCAAAGAAACGGATTT pLKO_005 931 CDS 100% 10.800 7.560 N Melk n/a
9 TRCN0000220739 GCAGCTCCTGAACTAATACAA pLKO.1 717 CDS 100% 5.625 3.938 N Melk n/a
10 TRCN0000220737 GCTGGATTGATAGACTATGAA pLKO.1 1287 CDS 100% 5.625 3.938 N Melk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010790.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.