Transcript: Mouse NM_010839.6

Mus musculus C-x(9)-C motif containing 4 (Cmc4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Cmc4 (105886298)
Length:
1011
CDS:
581..787

Additional Resources:

NCBI RefSeq record:
NM_010839.6
NBCI Gene record:
Cmc4 (105886298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010839.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353352 GTAAGTGTTGTGCTCGATATC pLKO_005 687 CDS 100% 10.800 15.120 N Mtcp1 n/a
2 TRCN0000328416 CAACTATTTGGAATCGAAGTG pLKO_005 643 CDS 100% 4.050 5.670 N Mtcp1 n/a
3 TRCN0000120606 GTGCTCGATATCCCAAAGGAA pLKO.1 696 CDS 100% 3.000 4.200 N Mtcp1 n/a
4 TRCN0000120604 CAAGCCAACAACTATTTGGAA pLKO.1 635 CDS 100% 3.000 2.400 N Mtcp1 n/a
5 TRCN0000120602 GTAGCAGCAAACAGCAAATTA pLKO.1 864 3UTR 100% 15.000 10.500 N Mtcp1 n/a
6 TRCN0000328418 TGAAGTCTGGATCCAAGTAAA pLKO_005 768 CDS 100% 13.200 9.240 N Mtcp1 n/a
7 TRCN0000120603 CGTAAGTGTTGTGCTCGATAT pLKO.1 686 CDS 100% 10.800 7.560 N Mtcp1 n/a
8 TRCN0000328415 CTCTTGTCTGCTCAGGATTTG pLKO_005 720 CDS 100% 10.800 7.560 N Mtcp1 n/a
9 TRCN0000328417 TTTACTGTCCCTCCTTCAATC pLKO_005 840 3UTR 100% 10.800 7.560 N Mtcp1 n/a
10 TRCN0000107148 TGTCAGGCTGTCATCCAAGAA pLKO.1 662 CDS 100% 4.950 3.465 N MTCP1 n/a
11 TRCN0000120605 CTGTCATCCAAGAACTTCGTA pLKO.1 669 CDS 100% 3.000 2.100 N Mtcp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010839.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05748 pDONR223 100% 86.7% 88.2% None (many diffs) n/a
Download CSV