Transcript: Mouse NM_010848.3

Mus musculus myeloblastosis oncogene (Myb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Myb (17863)
Length:
3420
CDS:
267..2177

Additional Resources:

NCBI RefSeq record:
NM_010848.3
NBCI Gene record:
Myb (17863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426969 GTTAGCTAAATCCCAAGTAAT pLKO_005 2640 3UTR 100% 13.200 10.560 N Myb n/a
2 TRCN0000417642 TGTCGCATTGCATGTTAATAT pLKO_005 1052 CDS 100% 15.000 10.500 N Myb n/a
3 TRCN0000042502 CAACAGCGAATATCCCTATTA pLKO.1 986 CDS 100% 13.200 9.240 N Myb n/a
4 TRCN0000042500 CCCTGGACCAAAGAAGAAGAT pLKO.1 546 CDS 100% 4.950 3.465 N Myb n/a
5 TRCN0000040059 GCTATCAAGAACCACTGGAAT pLKO.1 804 CDS 100% 4.950 3.465 N MYB n/a
6 TRCN0000288601 GCTATCAAGAACCACTGGAAT pLKO_005 804 CDS 100% 4.950 3.465 N MYB n/a
7 TRCN0000042498 GCTCCTGATGTCAACAGAGAA pLKO.1 1166 CDS 100% 4.950 3.465 N Myb n/a
8 TRCN0000042501 GCCAACTGAGAAATCGGGAAA pLKO.1 1850 CDS 100% 4.050 2.835 N Myb n/a
9 TRCN0000042499 CCATCTTTAGAACTCCAGCTA pLKO.1 1597 CDS 100% 2.640 1.848 N Myb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01052 pDONR223 100% 87.2% 90.4% None (many diffs) n/a
2 ccsbBroad304_01052 pLX_304 0% 87.2% 90.4% V5 (many diffs) n/a
Download CSV