Transcript: Mouse NM_010897.2

Mus musculus neurofibromin 1 (Nf1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nf1 (18015)
Length:
11847
CDS:
109..8634

Additional Resources:

NCBI RefSeq record:
NM_010897.2
NBCI Gene record:
Nf1 (18015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034342 GCCAACCTTAACCTCTCTAAT pLKO.1 8434 CDS 100% 13.200 10.560 N Nf1 n/a
2 TRCN0000034341 CCCTTCTTCTTACTGATATTT pLKO.1 7493 CDS 100% 15.000 10.500 N Nf1 n/a
3 TRCN0000034343 CCAAGCTAGAAGTGGCCTTAT pLKO.1 2168 CDS 100% 10.800 7.560 N Nf1 n/a
4 TRCN0000039717 GCTGGCAGTTTCAAACGTAAT pLKO.1 8593 CDS 100% 10.800 7.560 N NF1 n/a
5 TRCN0000034339 CCCTGTAAATAGTTTGTGTAA pLKO.1 11384 3UTR 100% 4.950 3.465 N Nf1 n/a
6 TRCN0000039715 CCTCACAACAACCAACACTTT pLKO.1 1270 CDS 100% 4.950 3.465 N NF1 n/a
7 TRCN0000039716 CCTGACACTTACAACAGTCAA pLKO.1 6958 CDS 100% 4.950 3.465 N NF1 n/a
8 TRCN0000034340 CGGATGAATTTACAAAGCTAT pLKO.1 791 CDS 100% 4.950 3.465 N Nf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.