Transcript: Mouse NM_010904.3

Mus musculus neurofilament, heavy polypeptide (Nefh), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Nefh (380684)
Length:
4004
CDS:
131..3403

Additional Resources:

NCBI RefSeq record:
NM_010904.3
NBCI Gene record:
Nefh (380684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090083 CGCAATAATGAATGAGCAGTT pLKO.1 3760 3UTR 100% 4.050 3.240 N Nefh n/a
2 TRCN0000090084 CCTCCATATCCACGCACATAA pLKO.1 1413 CDS 100% 13.200 9.240 N Nefh n/a
3 TRCN0000090087 CCAAGAGGAGATAACTGAGTA pLKO.1 1066 CDS 100% 4.950 3.465 N Nefh n/a
4 TRCN0000090086 CCCTCCATATCCACGCACATA pLKO.1 1412 CDS 100% 4.950 3.465 N Nefh n/a
5 TRCN0000090085 CTTTCCAAAGAGCCTAGCAAA pLKO.1 3281 CDS 100% 4.950 3.465 N Nefh n/a
6 TRCN0000422042 TGGACAATTATGATAGCTTAT pLKO_005 3626 3UTR 100% 10.800 15.120 N NEFH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.