Transcript: Mouse NM_010947.3

Mus musculus netrin 3 (Ntn3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ntn3 (18209)
Length:
4912
CDS:
402..2144

Additional Resources:

NCBI RefSeq record:
NM_010947.3
NBCI Gene record:
Ntn3 (18209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094079 CGGGCCAATGTGATTCATCAA pLKO.1 2472 3UTR 100% 4.950 6.930 N Ntn3 n/a
2 TRCN0000094083 CGGGAGGGCTTCTATCGTGAT pLKO.1 1461 CDS 100% 1.350 1.890 N Ntn3 n/a
3 TRCN0000094081 CAGTTACCGAATCAGCCTGAA pLKO.1 1751 CDS 100% 4.050 3.240 N Ntn3 n/a
4 TRCN0000094082 GCACTGCAAGTCCTCTCTGTT pLKO.1 658 CDS 100% 4.950 3.465 N Ntn3 n/a
5 TRCN0000094080 CGGTGTCTGTTGGACACCCAT pLKO.1 1188 CDS 100% 0.088 0.062 N Ntn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.