Transcript: Mouse NM_011015.2

Mus musculus origin recognition complex, subunit 1 (Orc1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Orc1 (18392)
Length:
3027
CDS:
134..2656

Additional Resources:

NCBI RefSeq record:
NM_011015.2
NBCI Gene record:
Orc1 (18392)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071185 GCCTAATAAACCTCGTGAAAT pLKO.1 973 CDS 100% 13.200 18.480 N Orc1 n/a
2 TRCN0000336406 TACGGTAACATACTATGTATA pLKO_005 2806 3UTR 100% 13.200 18.480 N Orc1 n/a
3 TRCN0000374757 CCTAACACGAGGTGGTCAAAG pLKO_005 869 CDS 100% 10.800 15.120 N Orc1 n/a
4 TRCN0000071184 GCCCACTTAATGGAAGCTATA pLKO.1 2315 CDS 100% 10.800 8.640 N Orc1 n/a
5 TRCN0000353389 TCTTGACTTTGAAGCGGATTA pLKO_005 1266 CDS 100% 10.800 8.640 N Orc1 n/a
6 TRCN0000374770 GCTTTGTCTCAGAGCTTTATT pLKO_005 2675 3UTR 100% 15.000 10.500 N Orc1 n/a
7 TRCN0000336404 ACCAGACTCCTGCTAATATTG pLKO_005 792 CDS 100% 13.200 9.240 N Orc1 n/a
8 TRCN0000336339 TTCAATATGTTGAGGTTAATG pLKO_005 1758 CDS 100% 13.200 9.240 N Orc1 n/a
9 TRCN0000071186 GCACAGGAGATATTCTGGTAT pLKO.1 455 CDS 100% 4.950 3.465 N Orc1 n/a
10 TRCN0000071183 GCAGAATATACAGGATGGAAA pLKO.1 2722 3UTR 100% 4.950 3.465 N Orc1 n/a
11 TRCN0000071187 CTGAGGAATTTAAGGGCCTTT pLKO.1 2150 CDS 100% 4.050 2.835 N Orc1 n/a
12 TRCN0000374689 TGGCTAAACTGATTGAATTAT pLKO_005 324 CDS 100% 15.000 9.000 N Orc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.