Transcript: Mouse NM_011083.2

Mus musculus phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha (Pik3c2a), mRNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Pik3c2a (18704)
Length:
8042
CDS:
217..5277

Additional Resources:

NCBI RefSeq record:
NM_011083.2
NBCI Gene record:
Pik3c2a (18704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011083.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024891 CCTGCGTTTGACATTATTTAT pLKO.1 2743 CDS 100% 15.000 21.000 N Pik3c2a n/a
2 TRCN0000024889 CGGCAAGATATGTTAGCTTTA pLKO.1 3646 CDS 100% 10.800 15.120 N Pik3c2a n/a
3 TRCN0000199065 CCACCCTTTACTTCGTGATGA pLKO.1 4809 CDS 100% 4.950 6.930 N PIK3C2A n/a
4 TRCN0000350691 AGAACTACTAAGTCGTTTATA pLKO_005 5696 3UTR 100% 15.000 10.500 N Pik3c2a n/a
5 TRCN0000322023 CACCTAACAACAGCGATTTAT pLKO_005 2155 CDS 100% 15.000 10.500 N Pik3c2a n/a
6 TRCN0000322022 GATATTGCTGGACGACAATTT pLKO_005 522 CDS 100% 13.200 9.240 N Pik3c2a n/a
7 TRCN0000322021 TCTATGCCGCACACGGAATTT pLKO_005 2285 CDS 100% 13.200 9.240 N Pik3c2a n/a
8 TRCN0000196636 GCCTACAACTTGATAAGAAAG pLKO.1 4171 CDS 100% 10.800 7.560 N PIK3C2A n/a
9 TRCN0000024890 GCAGCTACATTCTGAAAGTTT pLKO.1 1622 CDS 100% 5.625 3.938 N Pik3c2a n/a
10 TRCN0000322020 GCAGCTACATTCTGAAAGTTT pLKO_005 1622 CDS 100% 5.625 3.938 N Pik3c2a n/a
11 TRCN0000024892 GCTCTTAGATTCCTATCACTA pLKO.1 1875 CDS 100% 4.950 3.465 N Pik3c2a n/a
12 TRCN0000024893 GCACACAGTTTGTATTGGCTT pLKO.1 3235 CDS 100% 2.640 1.848 N Pik3c2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011083.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.