Transcript: Mouse NM_011139.2

Mus musculus POU domain, class 2, transcription factor 3 (Pou2f3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pou2f3 (18988)
Length:
2522
CDS:
75..1370

Additional Resources:

NCBI RefSeq record:
NM_011139.2
NBCI Gene record:
Pou2f3 (18988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081575 GCGATTTCAAGATAACCCGAA pLKO.1 947 CDS 100% 2.160 3.024 N Pou2f3 n/a
2 TRCN0000081576 CCTGACTTTGGAGAAGCGATT pLKO.1 932 CDS 100% 4.050 3.240 N Pou2f3 n/a
3 TRCN0000081574 CGATTTCAAGATAACCCGAAA pLKO.1 948 CDS 100% 4.050 3.240 N Pou2f3 n/a
4 TRCN0000420652 ACCAAAGCCTTATCTTGTTAA pLKO_005 1829 3UTR 100% 13.200 9.240 N Pou2f3 n/a
5 TRCN0000417396 TTCAAGCAGAGACGCATTAAG pLKO_005 645 CDS 100% 13.200 9.240 N Pou2f3 n/a
6 TRCN0000081573 CCTAGATTTCAACAGACAGAT pLKO.1 188 CDS 100% 4.950 3.465 N Pou2f3 n/a
7 TRCN0000081577 GCCTAGATTTCAACAGACAGA pLKO.1 187 CDS 100% 2.640 1.848 N Pou2f3 n/a
8 TRCN0000230047 AGAAGGAGGTGGTGAGAGTTT pLKO_005 1015 CDS 100% 4.950 2.475 Y POU3F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.