Transcript: Mouse NM_011206.2

Mus musculus protein tyrosine phosphatase, non-receptor type 18 (Ptpn18), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ptpn18 (19253)
Length:
1587
CDS:
79..1440

Additional Resources:

NCBI RefSeq record:
NM_011206.2
NBCI Gene record:
Ptpn18 (19253)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029884 GCCTACGAAGAAGTAACAGAT pLKO.1 1330 CDS 100% 4.950 6.930 N Ptpn18 n/a
2 TRCN0000339367 AGGACCCTCCAGGTTACATTC pLKO_005 598 CDS 100% 10.800 8.640 N Ptpn18 n/a
3 TRCN0000339437 CTCGTGAGTTCAGCGACATTA pLKO_005 158 CDS 100% 13.200 9.240 N Ptpn18 n/a
4 TRCN0000339368 GTGCACCAGCTACAGTATATG pLKO_005 637 CDS 100% 13.200 9.240 N Ptpn18 n/a
5 TRCN0000339369 CCAGCAGTTCTGATCACATTC pLKO_005 680 CDS 100% 10.800 7.560 N Ptpn18 n/a
6 TRCN0000339439 CGAACAAGAACCGCTACAAAG pLKO_005 248 CDS 100% 10.800 7.560 N Ptpn18 n/a
7 TRCN0000029888 GCTCGTGAGTTCAGCGACATT pLKO.1 157 CDS 100% 4.950 3.465 N Ptpn18 n/a
8 TRCN0000029885 GCTTGGGAACACGAACAAGAA pLKO.1 237 CDS 100% 4.950 3.465 N Ptpn18 n/a
9 TRCN0000029887 GTAATCCTGATGGCCTGTCAA pLKO.1 454 CDS 100% 4.950 3.465 N Ptpn18 n/a
10 TRCN0000029886 GCTACAAAGATGTGGTAGCAT pLKO.1 260 CDS 100% 0.300 0.210 N Ptpn18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011206.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.