Transcript: Mouse NM_011226.1

Mus musculus RAB19, member RAS oncogene family (Rab19), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rab19 (19331)
Length:
1371
CDS:
95..748

Additional Resources:

NCBI RefSeq record:
NM_011226.1
NBCI Gene record:
Rab19 (19331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381831 GCTCATGGCGAAGGAGTTAAT pLKO_005 613 CDS 100% 13.200 18.480 N Rab19 n/a
2 TRCN0000382412 ACGCAGCTATCATCGCTTATG pLKO_005 366 CDS 100% 10.800 15.120 N Rab19 n/a
3 TRCN0000102678 CACGCAGCTATCATCGCTTAT pLKO.1 365 CDS 100% 10.800 15.120 N Rab19 n/a
4 TRCN0000102675 GCCCTCAAGGACTCCATTAAA pLKO.1 864 3UTR 100% 15.000 10.500 N Rab19 n/a
5 TRCN0000102679 CAGATGAGAATGTGGACTATT pLKO.1 123 CDS 100% 13.200 9.240 N Rab19 n/a
6 TRCN0000381350 TCGAGATAGACGGCAAGAAAG pLKO_005 270 CDS 100% 10.800 7.560 N Rab19 n/a
7 TRCN0000102677 GCATTTCAAATCTGGAGTCTA pLKO.1 199 CDS 100% 4.950 3.465 N Rab19 n/a
8 TRCN0000102676 GCAGCTATCATCGCTTATGAT pLKO.1 368 CDS 100% 0.563 0.394 N Rab19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10131 pDONR223 100% 86% 3.2% None (many diffs) n/a
2 ccsbBroad304_10131 pLX_304 0% 86% 3.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV