Transcript: Mouse NM_011272.2

Mus musculus relaxin 1 (Rln1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rln1 (19773)
Length:
697
CDS:
75..632

Additional Resources:

NCBI RefSeq record:
NM_011272.2
NBCI Gene record:
Rln1 (19773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120356 CCATCCTTCATCAACAAAGAT pLKO.1 294 CDS 100% 5.625 3.938 N Rln1 n/a
2 TRCN0000146706 CCATCCTTCATCAACAAAGAT pLKO.1 294 CDS 100% 5.625 3.938 N RLN2 n/a
3 TRCN0000150355 CCATCCTTCATCAACAAAGAT pLKO.1 294 CDS 100% 5.625 3.938 N RLN1 n/a
4 TRCN0000149368 GTGCCATCCTTCATCAACAAA pLKO.1 291 CDS 100% 5.625 3.938 N RLN2 n/a
5 TRCN0000120352 CCTTTCGATACGACGCTGAAA pLKO.1 321 CDS 100% 4.950 3.465 N Rln1 n/a
6 TRCN0000149932 GCCATCCTTCATCAACAAAGA pLKO.1 293 CDS 100% 4.950 3.465 N RLN2 n/a
7 TRCN0000120355 CCAGGGCTTAAATACTTGCAA pLKO.1 507 CDS 100% 3.000 2.100 N Rln1 n/a
8 TRCN0000120354 CCTGTGTTGAGCGATTCTGTT pLKO.1 420 CDS 100% 4.950 2.970 N Rln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.