Transcript: Mouse NM_011320.1

Mus musculus NK1 transcription factor related, locus 1 (Drosophila) (Nkx1-1), mRNA.

Source:
NCBI, updated 2015-03-25
Taxon:
Mus musculus (mouse)
Gene:
Nkx1-1 (672284)
Length:
1323
CDS:
1..1323

Additional Resources:

NCBI RefSeq record:
NM_011320.1
NBCI Gene record:
Nkx1-1 (672284)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240235 TCCGTGTTGGACATCCTAGAT pLKO_005 250 CDS 100% 4.950 6.930 N Nkx1-1 n/a
2 TRCN0000240653 TTAAGGCCACTCGCTACCTGT pLKO_005 920 CDS 100% 2.640 3.696 N Nkx1-1 n/a
3 TRCN0000240236 TGGCGCTGGAGAACAAGTTTA pLKO_005 902 CDS 100% 13.200 9.240 N Nkx1-1 n/a
4 TRCN0000240237 CCTAGATCCCAACAAGTTCAA pLKO_005 264 CDS 100% 4.950 3.465 N Nkx1-1 n/a
5 TRCN0000240234 ACAAGTTCAACAGTAGGAGAC pLKO_005 275 CDS 100% 2.250 1.575 N Nkx1-1 n/a
6 TRCN0000240651 CCGCCGAACCAAGTGGAAGAA pLKO_005 1014 CDS 100% 1.650 1.155 N Nkx1-1 n/a
7 TRCN0000240649 TTCACCTACGAGCAGCTCGTG pLKO_005 883 CDS 100% 0.720 0.504 N Nkx1-1 n/a
8 TRCN0000240650 AGGACGAGGACGAGGAAGAAG pLKO_005 566 CDS 100% 1.650 0.990 N Nkx1-1 n/a
9 TRCN0000240233 ACGCAGGTGAAGATCTGGTTC pLKO_005 988 CDS 100% 4.050 2.025 Y Nkx1-1 n/a
10 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 1001 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.