Transcript: Mouse NM_011327.4

Mus musculus sterol carrier protein 2, liver (Scp2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Scp2 (20280)
Length:
2664
CDS:
101..1744

Additional Resources:

NCBI RefSeq record:
NM_011327.4
NBCI Gene record:
Scp2 (20280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011327.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304913 GTTGGCTATGATATGAGTAAA pLKO_005 926 CDS 100% 13.200 18.480 N Scp2 n/a
2 TRCN0000105356 GCCATGAAACTACAGAACCTT pLKO.1 1694 CDS 100% 3.000 2.400 N Scp2 n/a
3 TRCN0000302622 GCCATGAAACTACAGAACCTT pLKO_005 1694 CDS 100% 3.000 2.400 N Scp2 n/a
4 TRCN0000311156 TAGTGCCTCACACTCAATTAC pLKO_005 2164 3UTR 100% 13.200 9.240 N Scp2 n/a
5 TRCN0000105357 CCACTCCAACTGATAAACATA pLKO.1 510 CDS 100% 5.625 3.938 N Scp2 n/a
6 TRCN0000302548 CCACTCCAACTGATAAACATA pLKO_005 510 CDS 100% 5.625 3.938 N Scp2 n/a
7 TRCN0000105359 GCTTCCCAATTCAGATAAGAA pLKO.1 1555 CDS 100% 5.625 3.938 N Scp2 n/a
8 TRCN0000105355 CCTCCCGAATAGCATGAGATA pLKO.1 1832 3UTR 100% 4.950 3.465 N Scp2 n/a
9 TRCN0000105358 CCCAGTACGTTTGAAGAGAAA pLKO.1 890 CDS 100% 4.950 2.970 N Scp2 n/a
10 TRCN0000302606 CCCAGTACGTTTGAAGAGAAA pLKO_005 890 CDS 100% 4.950 2.970 N Scp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011327.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06916 pDONR223 100% 22.8% 24.6% None (many diffs) n/a
2 ccsbBroad304_06916 pLX_304 0% 22.8% 24.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV