Transcript: Mouse NM_011338.2

Mus musculus chemokine (C-C motif) ligand 9 (Ccl9), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ccl9 (20308)
Length:
3008
CDS:
173..541

Additional Resources:

NCBI RefSeq record:
NM_011338.2
NBCI Gene record:
Ccl9 (20308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077008 GCCCTTTAGTTAGTAGTATTT pLKO.1 935 3UTR 100% 13.200 18.480 N Ccl9 n/a
2 TRCN0000426703 CCTCAATGACTACACATAATA pLKO_005 762 3UTR 100% 15.000 12.000 N Ccl9 n/a
3 TRCN0000077009 CCTGTCCTATAACTCACGGAT pLKO.1 346 CDS 100% 2.640 2.112 N Ccl9 n/a
4 TRCN0000421801 TGGCAGCTCAAACTATCTATA pLKO_005 880 3UTR 100% 13.200 9.240 N Ccl9 n/a
5 TRCN0000077010 CGGAGAGTTCAGAGATGCATT pLKO.1 476 CDS 100% 4.950 3.465 N Ccl9 n/a
6 TRCN0000077012 TCACACATGCAACAGAGACAA pLKO.1 240 CDS 100% 4.950 3.465 N Ccl9 n/a
7 TRCN0000077011 GAAATGTTTCACATGGGCTTT pLKO.1 305 CDS 100% 4.050 2.835 N Ccl9 n/a
8 TRCN0000414720 GAAGTCCAGAGCAGTCTGAAG pLKO_005 263 CDS 100% 4.050 2.835 N Ccl9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.