Transcript: Mouse NM_011412.3

Mus musculus slit homolog 3 (Drosophila) (Slit3), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Slit3 (20564)
Length:
5017
CDS:
60..4631

Additional Resources:

NCBI RefSeq record:
NM_011412.3
NBCI Gene record:
Slit3 (20564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253510 CGCTTGCTCATGCAGTAATAA pLKO_005 905 CDS 100% 15.000 12.000 N Slit3 n/a
2 TRCN0000253514 ACTTGCGACTGAACGACAATG pLKO_005 1666 CDS 100% 10.800 8.640 N Slit3 n/a
3 TRCN0000193074 CCTGAGCAATAATAGGATCAA pLKO.1 1748 CDS 100% 4.950 3.960 N Slit3 n/a
4 TRCN0000217721 GAACCTGCAACTGGACAATAA pLKO.1 539 CDS 100% 13.200 9.240 N Slit3 n/a
5 TRCN0000253512 TTCGTGGGCAAGGACTCTTAT pLKO_005 3543 CDS 100% 13.200 9.240 N Slit3 n/a
6 TRCN0000253513 TCACGTCGCTGGTACTCTATG pLKO_005 1129 CDS 100% 10.800 7.560 N Slit3 n/a
7 TRCN0000053416 CCTAGAACAGAACTCCATCAA pLKO.1 998 CDS 100% 4.950 3.465 N SLIT3 n/a
8 TRCN0000175911 GCTCCTTCAATGATCTGACAT pLKO.1 2581 CDS 100% 4.950 3.465 N Slit3 n/a
9 TRCN0000176222 GCTTTGTGTGACCAGAAGAAT pLKO.1 4257 CDS 100% 5.625 3.375 N Slit3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.