Transcript: Mouse NM_011520.3

Mus musculus syndecan 3 (Sdc3), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Sdc3 (20970)
Length:
4972
CDS:
135..1463

Additional Resources:

NCBI RefSeq record:
NM_011520.3
NBCI Gene record:
Sdc3 (20970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348586 ATGCTACCCACAACCGTTATC pLKO_005 465 CDS 100% 10.800 15.120 N Sdc3 n/a
2 TRCN0000071988 GCTCATCTACCGCATGAAGAA pLKO.1 1352 CDS 100% 4.950 3.960 N Sdc3 n/a
3 TRCN0000334195 GCTCATCTACCGCATGAAGAA pLKO_005 1352 CDS 100% 4.950 3.960 N Sdc3 n/a
4 TRCN0000071989 CATGCGGTTCATCCCTGATAT pLKO.1 416 CDS 100% 13.200 9.240 N Sdc3 n/a
5 TRCN0000071991 CACGTACCAGAAACCTGACAA pLKO.1 1421 CDS 100% 4.950 3.465 N Sdc3 n/a
6 TRCN0000334196 CACGTACCAGAAACCTGACAA pLKO_005 1421 CDS 100% 4.950 3.465 N Sdc3 n/a
7 TRCN0000071990 GACGACTCGTTTCCTGATGAT pLKO.1 327 CDS 100% 4.950 3.465 N Sdc3 n/a
8 TRCN0000334194 GACGACTCGTTTCCTGATGAT pLKO_005 327 CDS 100% 4.950 3.465 N Sdc3 n/a
9 TRCN0000071992 TCCACGACAATGCCATCGATT pLKO.1 1213 CDS 100% 4.950 3.465 N Sdc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.