Transcript: Mouse NM_011535.3

Mus musculus T-box 3 (Tbx3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tbx3 (21386)
Length:
4647
CDS:
784..3009

Additional Resources:

NCBI RefSeq record:
NM_011535.3
NBCI Gene record:
Tbx3 (21386)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095873 GCTGACGACTGTCGATATAAA pLKO.1 1255 CDS 100% 15.000 21.000 N Tbx3 n/a
2 TRCN0000348092 TGCTGACGACTGTCGATATAA pLKO_005 1254 CDS 100% 15.000 21.000 N Tbx3 n/a
3 TRCN0000348093 ATCGGATAAACACGGATTTAC pLKO_005 1422 CDS 100% 13.200 18.480 N Tbx3 n/a
4 TRCN0000095871 CGGCCAAGATTTCCACCACTA pLKO.1 1952 CDS 100% 4.050 3.240 N Tbx3 n/a
5 TRCN0000095870 GCGAATGTTCCCTCCGTTTAA pLKO.1 1173 CDS 100% 13.200 9.240 N Tbx3 n/a
6 TRCN0000333931 GCGAATGTTCCCTCCGTTTAA pLKO_005 1173 CDS 100% 13.200 9.240 N Tbx3 n/a
7 TRCN0000348157 TCCATTCCAGTTTGGTCAAAT pLKO_005 3049 3UTR 100% 13.200 9.240 N Tbx3 n/a
8 TRCN0000095869 CCTCCTAAACAAACTAACAAA pLKO.1 3431 3UTR 100% 5.625 3.938 N Tbx3 n/a
9 TRCN0000005079 CGTCACTTTCCACAAACTGAA pLKO.1 1386 CDS 100% 4.950 3.465 N TBX3 n/a
10 TRCN0000095872 GAAACAGAATTCATCGCCGTT pLKO.1 1606 CDS 100% 0.000 0.000 N Tbx3 n/a
11 TRCN0000334009 GAAACAGAATTCATCGCCGTT pLKO_005 1606 CDS 100% 0.000 0.000 N Tbx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.