Transcript: Mouse NM_011592.2

Mus musculus translocase of inner mitochondrial membrane 44 (Timm44), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Timm44 (21856)
Length:
1798
CDS:
19..1377

Additional Resources:

NCBI RefSeq record:
NM_011592.2
NBCI Gene record:
Timm44 (21856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366291 ATGGTTCAAGCTACCAGATAA pLKO_005 113 CDS 100% 13.200 18.480 N Timm44 n/a
2 TRCN0000114263 GTTGTATTCAACCGCTTCTTT pLKO.1 775 CDS 100% 5.625 7.875 N Timm44 n/a
3 TRCN0000374999 ACTCCAAAGGCGAGGTGTATG pLKO_005 1226 CDS 100% 10.800 8.640 N Timm44 n/a
4 TRCN0000114262 GCGTACCAGTGAAGCAATAAA pLKO.1 354 CDS 100% 15.000 10.500 N Timm44 n/a
5 TRCN0000366293 CAAAGATAACAACGTTGTATT pLKO_005 762 CDS 100% 13.200 9.240 N Timm44 n/a
6 TRCN0000366292 TTTGTCAGGCTTGCTAGATAA pLKO_005 195 CDS 100% 13.200 9.240 N Timm44 n/a
7 TRCN0000374941 CAGACACACAGAGACACTTTG pLKO_005 1424 3UTR 100% 10.800 7.560 N Timm44 n/a
8 TRCN0000374940 CATCCTAGAGGCCATGATTTC pLKO_005 996 CDS 100% 10.800 7.560 N Timm44 n/a
9 TRCN0000114264 CCATGGTTCAAGCTACCAGAT pLKO.1 111 CDS 100% 4.050 2.835 N Timm44 n/a
10 TRCN0000114265 TGAAAGTGACAATGTCCTCAT pLKO.1 816 CDS 100% 4.050 2.835 N Timm44 n/a
11 TRCN0000114261 CCACATCTGATACAGCTGTAA pLKO.1 1445 3UTR 100% 4.950 3.465 N Timm44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02445 pDONR223 100% 84.7% 89.6% None (many diffs) n/a
2 ccsbBroad304_02445 pLX_304 0% 84.7% 89.6% V5 (many diffs) n/a
Download CSV