Transcript: Mouse NM_011644.3

Mus musculus Xndc1-transient receptor potential cation channel, subfamily C, member 2 readthrough (Xntrpc), transcript variant Xndr-Trpc2 protein, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Xntrpc (102443351)
Length:
4506
CDS:
99..3893

Additional Resources:

NCBI RefSeq record:
NM_011644.3
NBCI Gene record:
Xntrpc (102443351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070060 CCTGGCTGACTAATCCTTCTA pLKO.1 655 CDS 100% 4.950 2.475 Y Trpc2 n/a
2 TRCN0000070062 GCCAATGTCAAATTCGACTTT pLKO.1 1479 CDS 100% 4.950 2.475 Y Trpc2 n/a
3 TRCN0000070058 GCCTTCTTTGACTCATCGATT pLKO.1 1623 CDS 100% 4.950 2.475 Y Trpc2 n/a
4 TRCN0000070059 CGGCATCTTTACCATCGTCAT pLKO.1 3077 CDS 100% 4.050 2.025 Y Trpc2 n/a
5 TRCN0000070061 GCCTGAGTTTAAGCCTCAGTA pLKO.1 1943 CDS 100% 0.495 0.248 Y Trpc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011644.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.