Transcript: Mouse NM_011646.5

Mus musculus trypsin 4 (Try4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Try4 (22074)
Length:
815
CDS:
14..754

Additional Resources:

NCBI RefSeq record:
NM_011646.5
NBCI Gene record:
Try4 (22074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011646.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031917 TCCTGGAAAGATCACCAATAA pLKO.1 538 CDS 100% 13.200 6.600 Y Try4 n/a
2 TRCN0000087340 ACCAATAACATGATCTGTGTT pLKO.1 551 CDS 100% 4.950 2.475 Y Try5 n/a
3 TRCN0000284639 CAAGATCGTTGGAGGATACAC pLKO_005 79 CDS 100% 4.950 2.475 Y Gm10334 n/a
4 TRCN0000031916 CCCTGTGGATGATGATGACAA pLKO.1 61 CDS 100% 4.950 2.475 Y Try4 n/a
5 TRCN0000183953 CCCTGTGGATGATGATGACAA pLKO.1 61 CDS 100% 4.950 2.475 Y Try5 n/a
6 TRCN0000031918 CTTGAGCTTTGGTGTGAACAA pLKO.1 454 CDS 100% 4.950 2.475 Y Try4 n/a
7 TRCN0000178759 CTTGAGCTTTGGTGTGAACAA pLKO.1 454 CDS 100% 4.950 2.475 Y Try5 n/a
8 TRCN0000087339 GACCCTGAACAACGACATCAT pLKO.1 319 CDS 100% 4.950 2.475 Y Try5 n/a
9 TRCN0000092387 GCTTTCCCTGTGGATGATGAT pLKO.1 56 CDS 100% 4.950 2.475 Y Try10 n/a
10 TRCN0000031914 CAGGACCCTGAACAACGACAT pLKO.1 316 CDS 100% 4.050 2.025 Y Try4 n/a
11 TRCN0000195843 CTTCAATAGCAGGACCCTGAA pLKO.1 307 CDS 100% 4.050 2.025 Y Try5 n/a
12 TRCN0000087342 CAAGATCATCAAGCATCCCAA pLKO.1 286 CDS 100% 2.640 1.320 Y Try5 n/a
13 TRCN0000031915 GCAGTTTGTCAATTCTGCCAA pLKO.1 268 CDS 100% 2.640 1.320 Y Try4 n/a
14 TRCN0000179298 GCAGTTTGTCAATTCTGCCAA pLKO.1 268 CDS 100% 2.640 1.320 Y Try5 n/a
15 TRCN0000196070 GCACAACATCAATGTCCTCGA pLKO.1 238 CDS 100% 2.160 1.080 Y Try5 n/a
16 TRCN0000281864 GCAATGAGCAGTTTGTCAATG pLKO_005 261 CDS 100% 10.800 5.400 Y Gm10334 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011646.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.