Transcript: Mouse NM_011674.4

Mus musculus UDP galactosyltransferase 8A (Ugt8a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ugt8a (22239)
Length:
3599
CDS:
101..1726

Additional Resources:

NCBI RefSeq record:
NM_011674.4
NBCI Gene record:
Ugt8a (22239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011674.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414671 GGAGACCATTATGATACTATG pLKO_005 1241 CDS 100% 10.800 15.120 N Ugt8a n/a
2 TRCN0000110422 CCCAATGATATGTGTGGATTT pLKO.1 515 CDS 100% 10.800 8.640 N Ugt8a n/a
3 TRCN0000110420 GCCATGTGTAAATGCTTATTT pLKO.1 2423 3UTR 100% 15.000 10.500 N Ugt8a n/a
4 TRCN0000110424 CCCTGGTGAAAGTTATCAATA pLKO.1 1335 CDS 100% 13.200 9.240 N Ugt8a n/a
5 TRCN0000110421 GCTCAGAAGTTATCGGAAATT pLKO.1 1376 CDS 100% 13.200 9.240 N Ugt8a n/a
6 TRCN0000110423 CCAATTATGTTTGAAAGCCAT pLKO.1 182 CDS 100% 2.640 1.848 N Ugt8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011674.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.