Transcript: Mouse NM_011693.3

Mus musculus vascular cell adhesion molecule 1 (Vcam1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Vcam1 (22329)
Length:
3398
CDS:
322..2541

Additional Resources:

NCBI RefSeq record:
NM_011693.3
NBCI Gene record:
Vcam1 (22329)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094143 CCAGATAGACAGCCCACTAAA pLKO.1 504 CDS 100% 13.200 18.480 N Vcam1 n/a
2 TRCN0000094141 CCAAATTGATTCTACACTCAA pLKO.1 927 CDS 100% 4.950 3.960 N Vcam1 n/a
3 TRCN0000094139 CCAGATCCTTAATACTGTTTA pLKO.1 2584 3UTR 100% 13.200 9.240 N Vcam1 n/a
4 TRCN0000094140 CCCTTTGACCATCTGGAGATT pLKO.1 1615 CDS 100% 4.950 3.465 N Vcam1 n/a
5 TRCN0000094142 CGAGGCTGGAATTAGCAGAAA pLKO.1 2070 CDS 100% 4.950 3.465 N Vcam1 n/a
6 TRCN0000123171 CGAGCTAAATTACACATTGAT pLKO.1 907 CDS 100% 5.625 4.500 N VCAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.