Transcript: Mouse NM_011836.3

Mus musculus laminin gamma 3 (Lamc3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lamc3 (23928)
Length:
5930
CDS:
64..4809

Additional Resources:

NCBI RefSeq record:
NM_011836.3
NBCI Gene record:
Lamc3 (23928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094680 CCCTTTATGCAGCTACGCAAT pLKO.1 4003 CDS 100% 4.050 5.670 N Lamc3 n/a
2 TRCN0000094682 CCCGGCTTTGTGGGCTATAAA pLKO.1 3055 CDS 100% 15.000 12.000 N Lamc3 n/a
3 TRCN0000426460 CGTTTGACAGGGAGCTCTATC pLKO_005 1100 CDS 100% 10.800 7.560 N Lamc3 n/a
4 TRCN0000423038 GATCCAGCACACCCACCAATT pLKO_005 3530 CDS 100% 10.800 7.560 N Lamc3 n/a
5 TRCN0000094679 CCCTGGCATTTCTTCCTGATA pLKO.1 5767 3UTR 100% 4.950 3.465 N Lamc3 n/a
6 TRCN0000094681 CCTGAAGCAATGAACTTCCAA pLKO.1 3859 CDS 100% 3.000 2.100 N Lamc3 n/a
7 TRCN0000094683 CCAGTCATACTGACCCTCCAA pLKO.1 1759 CDS 100% 2.640 1.848 N Lamc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.