Transcript: Mouse NM_011890.5

Mus musculus sarcoglycan, beta (dystrophin-associated glycoprotein) (Sgcb), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Sgcb (24051)
Length:
3733
CDS:
25..987

Additional Resources:

NCBI RefSeq record:
NM_011890.5
NBCI Gene record:
Sgcb (24051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011890.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436645 GCGTTTGCCATAACTTGTAAT pLKO_005 1071 3UTR 100% 13.200 18.480 N Sgcb n/a
2 TRCN0000431786 GTGATCGTCCTCCTGTTTATC pLKO_005 232 CDS 100% 13.200 18.480 N Sgcb n/a
3 TRCN0000412892 ACTATGAGACGCACGAGTTTC pLKO_005 578 CDS 100% 10.800 15.120 N Sgcb n/a
4 TRCN0000419488 AGCGGAGGAATGTTAACAAAG pLKO_005 113 CDS 100% 10.800 15.120 N Sgcb n/a
5 TRCN0000077355 GCAATTTCAAAGCTGGATATA pLKO.1 143 CDS 100% 13.200 10.560 N Sgcb n/a
6 TRCN0000077357 AGTACAAGTAACAGGTCACAA pLKO.1 921 CDS 100% 4.950 3.960 N Sgcb n/a
7 TRCN0000077356 CAATGCTACCAGTGACTTAAA pLKO.1 660 CDS 100% 13.200 9.240 N Sgcb n/a
8 TRCN0000077353 CCAGACACTAAGTGCAGATTT pLKO.1 2661 3UTR 100% 13.200 9.240 N Sgcb n/a
9 TRCN0000417849 CTATTATGTACTCTCCATATT pLKO_005 1119 3UTR 100% 13.200 9.240 N Sgcb n/a
10 TRCN0000077354 GCCGTCATCAATCTACTCATT pLKO.1 256 CDS 100% 4.950 3.465 N Sgcb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011890.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.