Transcript: Mouse NM_011941.3

Mus musculus mitogen-activated protein kinase binding protein 1 (Mapkbp1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mapkbp1 (26390)
Length:
6954
CDS:
354..4865

Additional Resources:

NCBI RefSeq record:
NM_011941.3
NBCI Gene record:
Mapkbp1 (26390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294948 GCCAAGCTAGCGCGTAGTATT pLKO_005 4086 CDS 100% 13.200 18.480 N Mapkbp1 n/a
2 TRCN0000294949 TTGACCTTCGATCCAACTAAT pLKO_005 1386 CDS 100% 13.200 18.480 N Mapkbp1 n/a
3 TRCN0000294898 TACAACGACCACAGCATATAT pLKO_005 1425 CDS 100% 15.000 10.500 N Mapkbp1 n/a
4 TRCN0000307462 ACCGGAATATTCGGATCTTTA pLKO_005 2248 CDS 100% 13.200 9.240 N Mapkbp1 n/a
5 TRCN0000088756 CCATCAAATTACGCAGAAGTA pLKO.1 415 CDS 100% 4.950 3.465 N Mapkbp1 n/a
6 TRCN0000088753 CCCAAGAGAAATGCTCTCCAT pLKO.1 4881 3UTR 100% 2.640 1.848 N Mapkbp1 n/a
7 TRCN0000287452 CCCAAGAGAAATGCTCTCCAT pLKO_005 4881 3UTR 100% 2.640 1.848 N Mapkbp1 n/a
8 TRCN0000088755 CCAGCATGACATGATTGTCAA pLKO.1 818 CDS 100% 0.495 0.347 N Mapkbp1 n/a
9 TRCN0000088754 CCTTAGCAAGAGCACCAAGAA pLKO.1 2756 CDS 100% 4.950 2.970 N Mapkbp1 n/a
10 TRCN0000088757 CCAGTCAACAACCTTCTCCAA pLKO.1 4440 CDS 100% 2.640 1.584 N Mapkbp1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5774 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 5832 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.