Transcript: Mouse NM_012039.2

Mus musculus zw10 kinetochore protein (Zw10), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zw10 (26951)
Length:
2917
CDS:
103..2442

Additional Resources:

NCBI RefSeq record:
NM_012039.2
NBCI Gene record:
Zw10 (26951)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_012039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098187 GCTCGCAATATCAATTCTCAT pLKO.1 1276 CDS 100% 4.950 6.930 N Zw10 n/a
2 TRCN0000316447 GCTCGCAATATCAATTCTCAT pLKO_005 1276 CDS 100% 4.950 6.930 N Zw10 n/a
3 TRCN0000098186 CCCGATTGTAAGGAAGCCTTA pLKO.1 1381 CDS 100% 4.050 5.670 N Zw10 n/a
4 TRCN0000316350 CCCGATTGTAAGGAAGCCTTA pLKO_005 1381 CDS 100% 4.050 5.670 N Zw10 n/a
5 TRCN0000098189 GCTGAAGTCATTTGGTCAGAT pLKO.1 822 CDS 100% 4.950 3.960 N Zw10 n/a
6 TRCN0000316348 GCTGAAGTCATTTGGTCAGAT pLKO_005 822 CDS 100% 4.950 3.960 N Zw10 n/a
7 TRCN0000098188 CGACTGAAGATGGTGATAGAT pLKO.1 2126 CDS 100% 5.625 3.938 N Zw10 n/a
8 TRCN0000316349 CGACTGAAGATGGTGATAGAT pLKO_005 2126 CDS 100% 5.625 3.938 N Zw10 n/a
9 TRCN0000098185 CCAGTATATCATGGAAGCGTA pLKO.1 2540 3UTR 100% 2.640 1.848 N Zw10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.