Transcript: Human NM_012210.3

Homo sapiens tripartite motif containing 32 (TRIM32), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
TRIM32 (22954)
Length:
3734
CDS:
162..2123

Additional Resources:

NCBI RefSeq record:
NM_012210.3
NBCI Gene record:
TRIM32 (22954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012210.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010787 GTGGTCAAATACAGCTGCCTA pLKO.1 1671 CDS 100% 2.640 3.696 N TRIM32 n/a
2 TRCN0000273176 ATAACTCCCTCAAGGTATATA pLKO_005 1507 CDS 100% 15.000 10.500 N TRIM32 n/a
3 TRCN0000273104 GACCGTGGTAACTATCGTATA pLKO_005 1326 CDS 100% 10.800 7.560 N TRIM32 n/a
4 TRCN0000273175 GCCACTTCTTCTCGGAGAATG pLKO_005 1858 CDS 100% 10.800 7.560 N TRIM32 n/a
5 TRCN0000273178 TGAAGTTGAGAAGTCCAATAG pLKO_005 794 CDS 100% 10.800 7.560 N TRIM32 n/a
6 TRCN0000003457 CAGTGCTAAAGATCATTGATA pLKO.1 403 CDS 100% 5.625 3.938 N TRIM32 n/a
7 TRCN0000003458 TCTTGGACTGTTGGGATCATT pLKO.1 2056 CDS 100% 5.625 3.938 N TRIM32 n/a
8 TRCN0000003455 CAGGCAAGGTATAAAGCAGTT pLKO.1 693 CDS 100% 4.050 2.835 N TRIM32 n/a
9 TRCN0000003456 CCATTTCTCTATCAAGCATTA pLKO.1 3126 3UTR 100% 10.800 6.480 N TRIM32 n/a
10 TRCN0000273103 CCATTTCTCTATCAAGCATTA pLKO_005 3126 3UTR 100% 10.800 6.480 N TRIM32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012210.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02708 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02708 pLX_304 0% 100% 100% V5 n/a
Download CSV